Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F036E05
Clone ID F036E05
Vector pT1ATGbetageo
Project ggtc

Sequence tag F036E05
Sequence
GTGCAGCTGCGGGAAGAGTCGTGTCAACTCTTCTTCGGTTACTGTCACTTCTTCTAATTTCAGGCTCCTTGGAGAGGACA
CAGTATGCATCAAAAGCAGAGAATGGAGCCTGTGACCTTTGAGGATGTGGCTGTGAACTTCAGCCTAGGAGAGTGGGCTC
TGCTGGATTCCAGTCAAAAGAAGCTCTACAGAGATGTGATGACGGAGACCTTTATGAATCTGATCTCCATAG
Sequence Type mRNA
Unitrap ID UNI12607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33130099..33138695 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053390 (C920016K16Rik) NM_001045559 RIKEN cDNA C920016K16 gene Gene [Source:MGI Symbol;Acc:MGI:2441928]

 
Come back to gene ENSMUSG00000053390


For any suggestions or comments, please send an email to unitrap@crg.es