Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F061B04
Clone ID F061B04
Vector pT1ATGbetageo
Project ggtc

Sequence tag F061B04
Sequence
ATGTCAGAATCAGAAACTTCAATGTTAGCATCAGAGGCTGTTATGACTGTTCCAGAACCTGCACGAGAGCCCGAGTCTTC
AGTTACATCAGCACCAGTTGAGTCTGCTGTAGTAGCAGAACATGAAATGGTTCCAGAGAGACCGATGACTTACATGGTTT
CTGAGTCTACTATGTCATTCCATGCCACACTAA
Sequence Type mRNA
Unitrap ID UNI12617

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91658284..91658469 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]

 
Come back to gene ENSMUSG00000022961


For any suggestions or comments, please send an email to unitrap@crg.es