Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14426E3
Clone ID IST14426E3
Vector VICTR74
Project tigm

Sequence tag IST14426E3HMF1
Sequence
TATTAATTCCCCATCGACCGTTTCACTTTCTGCAGCTCTCACTGTAAATAATTATTTTAGTACAATCACTCACAGACAGT
TTCTCTGAAGAAAAATGTATTCAAGCTACGCAGCTTAACAGTTTTATTGTGGAACCTGTTGATACTCTAAACAAGTACAG
CTAGTGGTTTAAATAGCTTTGTAGGAGCCGGATGGTGATGGTACATCCAAGCATTCAGGAGGCAGAGGTAAGCAC
Sequence Type genomic DNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138535..53138768 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]


Sequence tag IST14426E3HMR1
Sequence
AATAGGCATTGCANACAGGCTTGTTTCTAGAAAGGGCGATAGGAAGGAGGCAGGTACGCTGAAGAGGGAAAAGTTTGGGA
TCTTGAGAGGGAAGATGTGGGATCAAGCATCCAGGCTACCCTTGACATGTGGACCGGACAGAGGAACACAGACCACCCAA
CGACCAATTCTTGGATTCATTTCGAACTCTCTTCAAATCCCGCTCAGTTCAGCAGCCTGCGCCCGCTCACTAGCTAGCGG
ACAGGCGTCTGCACGCCCCCAGCCCTCCTGCACACCCCACAAGCATCTCACTTACGCTTTCCTTCGAGCTATGAGCCGAT
GCATGGGAGTCGCCATCTTGGAGCGGCTGGANTCTGCCNCACGGGTTTTTGGGAAACTANCACCGGTGGGNNGGTCCNTA
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138139..53138538 386
NO GENE  


Sequence tag IST14426E3BBF1
Sequence
TATTAATTCCCCATCGACCGTTTCACTTTCTGCAGCTCTCACTGTAAATAATTATTTTAGTACAATCACTCACAGACAGT
TTCTCTGAAGAAAAATGTATTCAAGCTACGCAGCTTAACAGTTTTATTGTGGAACCTGTTGATACTCTAAACAAGTACAG
CTAGTGGTTTAAATAGCTTTGTAGGAGCCGGATGGTGATGGTACATCCAAGCATTCAGGAGGCAGAGGTAAGCAGATTTC
AGAATTCGGGGCCAGCCTGGTCTACANAGTGAGTTCCAGGACANCCNANGCTACACANAAAANCCCTGTCTCTCTNANNN
CANAN
Sequence Type genomic DNA
Unitrap ID UNI11583

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53138535..53138849 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018239 (Zcchc10) NM_026479 zinc finger, CCHC domain containing 10 Gene [Source:MGI (curated);Acc:Zcchc10-001]

 
Come back to gene ENSMUSG00000018239


For any suggestions or comments, please send an email to unitrap@crg.es