Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A017B06
Clone ID A017B06
Vector pT1betageo
Project ggtc

Sequence tag A017B06
Sequence
GAAAGGACGANAGCGNNGCGCGGGNNGGGGAGAGGGACGGGCAGAGTGGCGTACGCGGAAAGCGGANNAGGGGNNGNNAG
GAACAGAATCATGGACGCAGAACGGACGAAACCAAGANNGACAAAAAAAACAAAANNGGACACAACGCACCAGNNGAGGN
NGGTNNGGAANNAAGAGGGNNNNCGCAAGAGGCGGGAGAAGCAAGGANGGAGTGGCAGANNTGGNNAGGCGGGAGAAGAG
AAAGAGCGAGAGGGGNNGGNNGGAAANNGAAGGGAGGNNAAAGAGNNNAAGGNNNNGNNGANNCGAAGGCNNCTCANNGN
NCGCGCCACACCCGCGGNNGCGGAGGGGAGAGCGNNNCNNNGNAGGAAANNNNGGAAGGNNAAGGACNNAAGGACGACGC
GAGAAGAAANNNGAAAANAACNNTCCCGGTGTCTTTCAAGAAGTAGAGAAATCTCCCACCGCTTGTTTTGAAAATAAATG
ATACATTTGAATCTAATAGAGGCAAGAATAGGGTAAAGTTACAGCCTTACACTGGAAAGGAAGCCCCCTCCTCTAAAGGT
GAAACCAGTGGGAACGAGAGCGATGCCGAGTACCTGCCAAAGA
Sequence Type mRNA
Unitrap ID UNI12637

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102941203..102950479 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es