Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W121D01
Clone ID W121D01
Vector pT1betageo
Project ggtc

Sequence tag W121D01
Sequence
CCCGACAAACACCACGAGAATTCCGCAGCCCACACGGTGACAGAAACCCCATACCCTGTGACTTCTGGACTCTTGCTGTC
AGTGTGTCCCTTCCTCGTGCTCTGGATGATGTCAGAGCAGGACCTGGCGGATGTGGTTCAGATTGCAGTGGAAGACCTGA
GCCCTGATCACCCAG
Sequence Type mRNA
Unitrap ID UNI12408

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124498326..124498465 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es