Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14814A11
Clone ID IST14814A11
Vector VICTR76
Project tigm

Sequence tag IST14814A11HMF1
Sequence
ACCTGAGACAGTCTTGCCCCCCCCCTTTTCCTCCCAGCCTCTGAGCTATAAGCACCAGAAAGGGGTCTTACGAAGTCAGC
TTCAGTCCTGCTCTACACACACATACACACACACACACACAAACACACACACACACACGCACACACACACACACACACAC
NTNTCCCCCNNGCT
Sequence Type genomic DNA
Unitrap ID UNI31574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166955848..166956016 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050556 (Kcnb1) NM_008420 potassium voltage gated channel, Shab-related subfamily, member 1 Gene [Source:MGI (curated);Acc:Kcnb1-001]


Sequence tag IST14814A11BBF1
Sequence
ACCTGAGACAGTCTTGCCCCCCCCCTTTTCCTCCCAGCCTCTGAGCTATAAGCACCAGAAAGGGGTCTTACNAAGTCAGC
TTCAGTCCTGCTCTACACACACATACACACACACACACACAAACACACACACACACACNCACACACACACACACACACAC
NTNTCCCCCG
Sequence Type genomic DNA
Unitrap ID UNI31574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166955848..166956016 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050556 (Kcnb1) NM_008420 potassium voltage gated channel, Shab-related subfamily, member 1 Gene [Source:MGI (curated);Acc:Kcnb1-001]

 
Come back to gene ENSMUSG00000050556


For any suggestions or comments, please send an email to unitrap@crg.es