Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12316A3
Clone ID IST12316A3
Vector VICTR76
Project tigm

Sequence tag IST12316A3BBF1
Sequence
CAGATGGTCGTAAACACCATGTGGTCGCTGGGATTTGAACTCAGGACCTCTGGAAGATCAGTCAGTGCTCTTAACTGTTC
AGCCATCTCTCCAGCCAAGAGCCCACAATTTTGATCACAGTTTTTCAAAACACTTGTTTTTGTTTTTTGTTTTTTTTTTN
TTTGTTTNTTTTTTGTTTNGCCTAACTTTGTTTNGTTTNAAN
Sequence Type genomic DNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94002709..94002909 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es