Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12886F10
Clone ID IST12886F10
Vector VICTR76
Project tigm

Sequence tag IST12886F10HMF1
Sequence
AGANACAGAATCTTACTATGTANCACTGGCTGTCTANAACTTGCTATGTANACCAAGCTGGCACAGANATCCACTTGCCT
CGGCCTCCTGAATGTTAGGTTTAAATTGTGAACCACCATATCTGGCTGCCCTGCCGGGTCTAATTCTTCCTTTCC
Sequence Type genomic DNA
Unitrap ID UNI13070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27840342..27840496 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040276 (Pacsin1) NM_011861 protein kinase C and casein kinase substrate in neurons 1 Gene [Source:MGI (curated);Acc:Pacsin1-001]

 
Come back to gene ENSMUSG00000040276


For any suggestions or comments, please send an email to unitrap@crg.es