Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13124A7
Clone ID IST13124A7
Vector VICTR76
Project tigm

Sequence tag IST13124A7BBF1
Sequence
NGAGNNANTGGANGGANNNGNNGGGCTGGCCTCNAACTCAAAAATTCTCCTGCCTCTGCCTCCCAAGAGCTGGGATTAAA
GGCGTGCACCACCATGCCTGACTTAAAATTTTATTATCATCATCATTATCACCATGATGTGTTCATGTACACAGCACAGA
AGTGAGAGGACAGTTTTGTGGAGTGGGTTCTCCTCCCATGGTTCCNGGAATGAAACTCATTTCCTCANGCTTTTGAGGCC
TCCACCCNCTGAACCAACTCACCANGCCTACTTGTGGGCATTTTCATTTCNNTTAAGCCTCTTTGGAAAGGCNNGCATCN
Sequence Type genomic DNA
Unitrap ID UNI17702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57025096..57025391 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST13124A7HMF2
Sequence
CTGTCACATTTTAATGTCTGAAAAGTTGCACCCTGAGAGAACACATCCGACAGTCAGATGTGAATTGATGTCCCTGACAA
TACACCAGCACCTCACCGTAAGTGGCCCTGCTCTTTTGGCCTTTTAAGTTTTTTTCCTGGCAGACCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84693125..84693273 149
 
EST/CDNA Est Name
  BB848599.1 - BY236277.1 - BB849092.1

 
Come back to gene BB848599.1 - BY236277.1 - BB849092.1


For any suggestions or comments, please send an email to unitrap@crg.es