Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A018D07
Clone ID A018D07
Vector pT1betageo
Project ggtc

Sequence tag A018D07
Sequence
CAGGGACTCTCTTTCAGATGAACAGAGACCAGCTACAAAAGTTTGTTCAGTATTTGATCACAGTGCACCACACAGAAGTC
TTGCCAACTGCACAGAAGCTAGCAGATGAAATTCTCTCCCAGAATTCAGAAATCAACCAAGTTCATG
Sequence Type mRNA
Unitrap ID UNI298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108577847..108577993 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]

 
Come back to gene ENSMUSG00000032846


For any suggestions or comments, please send an email to unitrap@crg.es