Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A027F04
Clone ID A027F04
Vector pT1betageo
Project ggtc

Sequence tag A027F04
Sequence
GAAGNNTNCCCCCATCCCGGTCAAANAGTCCGGTCCTTAGGNNNGGGTCAAGCGAGGGCAGGCTCAGTGCGGTGTTTGTC
CCCCCCGCACTGACGGGTGGCCTGGCGGTGAGCGGCGGCAGCGGCGGCGGGGAAGATGGCGGCGTCCTCCCTGGAGCAGA
AGCTGTCCCGCCTGGAAGCCAAGCTGAAGCAGGAGAACCGTGAGGCCCGCAGGAGGATCGACCTGAACTTGGATATCAGC
CCACAGCGGCCCAGGCCCA
Sequence Type mRNA
Unitrap ID UNI12646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4238819..4239033 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002948 (Map2k7) NM_011944 mitogen-activated protein kinase kinase 7 Gene [Source:MGI (curated);Acc:Map2k7-003]

 
Come back to gene ENSMUSG00000002948


For any suggestions or comments, please send an email to unitrap@crg.es