Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10927E7
Clone ID IST10927E7
Vector VICTR76
Project tigm

Sequence tag IST10927E7HMF1
Sequence
TTATTAATTGAAAAATGATTCGGGGTTGGGGGGAGGGGAATCAACCTAAAATTCTATATTCAATTGAGCTGCAAATCCAA
GGTAAATATGGATTTGCTAAGTATCCATAAGTATTGCTAGGTCAAAAGACCTGGGAAAAGTGCTCTGCGGAGCTGGGGGT
GAAGCTCAGAAGTAGTGCTTACTTATCCAGTGAGCAAGAGAATCTAAGTTTCATTGCCNGCTTCGAGATGAACAGAGAAA
ACGAGGCATAAAGGCTGGCAAGGTGACCCAGCAGAGAAACGGATCTGCTGCCGAGTCTGAGGCTCTGGGTTCGATCCCAA
AGGAGAAAAGCAAC
Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7589883..7590213 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]


Sequence tag IST10927E7BBF1
Sequence
TTATTAATTGANAAATGATTCGGGGTTGGGGGGAGGGGAATCAACCTAAAATTCTATATTCAATTGAGCTGCAAATCCAA
GGTAAATATGGATTTGCTAAGTATCCATAANTATTGCTAGGTCAAAAGACCTGGGAAAAGTGCTCTGCGGAGCTGGGGGT
GAAGCTCAGAAGTANTGCTTACTTATCCAGTGAGCAAGAGAATCTAAGTTTNNTTGCCNNCTTCNANATGAACAGANAAA
ACGAGGCATAAAGGCTGGCAAGGTGACCCAGCAGANAAACGGATCTGCTGCCGAGTCTGAGGCTNTGGGNNCNANCCCAA
AGGAGAAAAGCAAATCCCAAGACTTGTCTTCTGACCTCCACACATGTGCCACGGCACACACACNTGCATGGGCACGTGCG
CGCATTTGTGCGCGCGCACACTCAACATTAAATCAATAAATAN

Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7589774..7590213 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es