Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14824G12
Clone ID IST14824G12
Vector VICTR76
Project tigm

Sequence tag IST14824G12HMF1
Sequence
GTTTTTGTGATGAAACATCGTGACTAAAAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI13150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27940478..27940512 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]


Sequence tag IST14824G12HMR1
Sequence
CCTANCCCTACNTNNNANNGNAACTAACAAAAGAAGAAGAAAGAACCTTCGTGCAACCATCTTGTAAGGAGTTCAGGCTC
ACCCGTGGATCCTGTGGGCGACAGACTGCTGCGGCTCACACAGCATTTGGTGTACTGGAAGACAAACTGCTAGCCATTGT
TTCTAACAAAACAAGAAAACCATGGCTTAATCTAAATCTAATTACGATGCTACACTTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27940517..27940736 204
 
EST/CDNA Est Name
  BE688798.1 - AI835178.1 - AI666342.1 - AW123169.1 - BE957410.1 - BE952887.1

 
Come back to gene BE688798.1 - AI835178.1 - AI666342.1 - AW123169.1 - BE957410.1 - BE952887.1


For any suggestions or comments, please send an email to unitrap@crg.es