Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W121E01
Clone ID W121E01
Vector pT1betageo
Project ggtc

Sequence tag W121E01
Sequence
TGCCTTCTCCGCGCGCCCGCTGACGGGCGGGGAGCCTGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGA
ATGTCGCGTCTCTCTGAGGCACCACGATCCGGGACTACACCGAGATGAACGATCTGCAGAAGCGTCTGGGACCTCGTGGA
CTGGTGGTGCTCGGTTTCCCGTGCAATCAGTTCGGACACCAGGACAATGGCAAGAATCCATAGACTTTCAATTCCCTCAG
Sequence Type mRNA
Unitrap ID UNI12653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108241688..108242144 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063856 (Gpx1) NM_008160 glutathione peroxidase 1 Gene [Source:MGI Symbol;Acc:MGI:104887]

 
Come back to gene ENSMUSG00000063856


For any suggestions or comments, please send an email to unitrap@crg.es