Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W065E03
Clone ID W065E03
Vector pT1betageo
Project ggtc

Sequence tag W065E03
Sequence
AAAGCGGGGTCTGTCGCAGGCCGCGGAGGAGCGTATGGAGGACCGTATCAGCCTGCTGCTCAGGCTGAGAGCTCAGACAA
AACAGCAGCTCTTAGAATATAAGTCCATGATCGACACAA
Sequence Type mRNA
Unitrap ID UNI12655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101542681..101545703 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045273 (Cenph) NM_021886 centromere protein H Gene [Source:MGI Symbol;Acc:MGI:1349448]

 
Come back to gene ENSMUSG00000045273


For any suggestions or comments, please send an email to unitrap@crg.es