Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579E2
Clone ID IST14579E2
Vector VICTR74
Project tigm

Sequence tag IST14579E2HMR1
Sequence
NNGGACGTAGCGAGAGCCTGGCTGAAGCCGGTAAAGGCGACCTGGACGGCGGGACACTCACCACACGACGTCTTGCCCTC
CCTGGACTCGCAGTAGCCGCAGTAGTAGCCGGCCTTCAGGCCCTTGTATTCCACCACCGAGGCCATGGCCGCCGCTGTGG
GCTTGAGGAGCGGCCACGCCTCTCAGCGCGGGGAACCTCGGGGAAGGGCCGAGAGCGCGGGGGTTGCCGGGTTCGCGGCT
CNNCGCGGATCCNNGGTCAGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137663332..137663591 250
 
EST/CDNA Est Name
  NM_001029895.2


Sequence tag IST14579E2HMF1
Sequence
TTGGCAGGCCTGCCGCGCGGGTTGAGGCCGTTGGTCACCCGACTCCAGCTTCCCGGTCCCATTGGTCTCTCCTCAGCCGG
CTTCCTTTCCATCCCGGTCTTCCCGCCCTCGCCCTCCCTAGGGGGTAGCCGCCCCTCACAGAGGAGGAACGGAACTAGCG
GACGGCTGCCCGCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI33293

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137663156..137663331 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030850 (Ate1) NM_001029895 arginyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333870]

 
Come back to gene ENSMUSG00000030850


For any suggestions or comments, please send an email to unitrap@crg.es