Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W036C06
Clone ID W036C06
Vector pT1betageo
Project ggtc

Sequence tag W036C06
Sequence
GGAGGGCCTAGCAGAGTTATATGAATATAAGAAGAAATATTCAGATACTGACATTGAACCATTTCTGAAAAATTCCTCGC
AGTTCTTTCAGAGTTATGTTGAGAGAGGCCTTCGGGTGGTTGAGATGGAGAGAGAAAGCAAAGGCCGGATTCTTACTTCA
ACAG
Sequence Type mRNA
Unitrap ID UNI9794

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91456456..91456617 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040549 (Ckap5) NM_029437 cytoskeleton associated protein 5 Gene [Source:MGI (curated);Acc:Ckap5-001]

 
Come back to gene ENSMUSG00000040549


For any suggestions or comments, please send an email to unitrap@crg.es