Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A008B05
Clone ID A008B05
Vector pT1betageo
Project ggtc

Sequence tag A008B05
Sequence
GGAGGGGAGTGGCCTTGTTCTCGATACTTCGTTGTGGTTGTGAACTCTGTCCGGCAGCCTCGGGCCTGCGGTCTTGAGAC
GGAGCACC
Sequence Type mRNA
Unitrap ID UNI2822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52045539..52045620 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036309 (Skp1a) NM_011543 S-phase kinase-associated protein 1A Gene [Source:MGI (curated);Acc:Skp1a-002]

 
Come back to gene ENSMUSG00000036309


For any suggestions or comments, please send an email to unitrap@crg.es