Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14489F12
Clone ID IST14489F12
Vector VICTR74
Project tigm

Sequence tag IST14489F12BBF1
Sequence
GTGCCTTCATGATCAAAATTCGATAGTCAATAGTACTAGAAGAATCATATGTCTGAAAATCCTTCCTTCCTTCCTTCCTT
CCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI30913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12302965..13240416 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047678 (Gpr82) NM_175669 G protein-coupled receptor 82 Gene [Source:MGI (curated);Acc:Gpr82-001]


Sequence tag IST14489F12HMF1
Sequence
NTGCCTTCATGATCNAAATTCGATAGTCNATAGTACTAGAANAATCATATGTCTGAAAATCCTTCCTTCCTTCCTTCCTT
CCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTTTCTT
TCTTTCTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161866: 370839..680644 104
 
EST/CDNA Est Name
  CA585559.1 - CA587596.1

 
Come back to gene CA585559.1 - CA587596.1


For any suggestions or comments, please send an email to unitrap@crg.es