Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A019C02
Clone ID A019C02
Vector pT1betageo
Project ggtc

Sequence tag A019C02
Sequence
CTANNNNTATGCTAAAAGAGGTCAGAGATCGTATAAAGAATGGAATATAAGCTCTCCCGACGTTCCTAGTTACTTTCAAG
GTGGATTGTGTATTTTAAGGCTGATGGGAGCGTCTGGTTTTTGGAGTAAAAAGAAGACAAGCTTGCTATGGCATTGTTCA
AGTACCTACTGGACCGTGGTTTTGTAGGAAATGTGAATCTCAGGAGAGAGCAGCCAGAGTGAGATGTGAGCTGTGTCCCC
ATAAAGATGGAGCTTTAAAAAGAACAGATAATGGGG
Sequence Type mRNA
Unitrap ID UNI12672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17976865..18023139 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es