Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14144E11
Clone ID IST14144E11
Vector VICTR74
Project tigm

Sequence tag IST14144E11HMR1
Sequence
GNNACACANTANAATAACACGGGATGAGCTGAACACAAACGGGGGAGTGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI11930

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59598014..59598065 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051705 (Senp8) NM_027838 SUMO/sentrin specific peptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1918849]


Sequence tag IST14144E11HMF1
Sequence
AAAGAGCGGATATTTTTTNATTTTCTTCTAATATTCTGGATTTTACAGCATANAAACAACTCAGTGAAAAGTCTGTGGAA
TGAATGGAAAGAAATACTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59598107..59598210 100
NO GENE  

 
Come back to gene ENSMUSG00000051705


For any suggestions or comments, please send an email to unitrap@crg.es