Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F020A06
Clone ID F020A06
Vector pT1betageo
Project ggtc

Sequence tag F020A06
Sequence
TACCCCACGTTCTNCCAACGGGTTCTTGTCTCTGTTAAAAAAACTTCCCTGACCCCGGTNNNTGTCAGGGTTGGCATAGT
GGGGTTGCCGTCTGAGCACCCGTCNNNGAGAGCCGACATCGGTCNNNNACTTAGTGAGGCTATGTGGAGATGGTGAAGCT
GTTCATTGGAAAGCTGCCCCGGGAGGCCACAGAGCAGGAGATCCGCTCACTCTTCGAGCAGTACGGGAAGGTGCTGGAAT
GTGACATCATTAAGAATTATGGCTTTGTCCACATAGAGGACAAGACGGCCGCTGAGGATGCCATACGCAACTTGCACCAC
TACAAGCTGCACGGAGTCAACATCAATGTGGAAGCCAGCAAGAATAAGAGCAAAGCTTCAACCAAGTTACACGTGGGCAA
CATCAGCCCCACTTGTACCAACCAAGAGCTTCGGGCCAAGTTTGAGGAGTACGGCCCGGTCATCGAATGTGACATCGTGA
AAGATTATGCCTTTATACACATGGAGCGGGCAGAGGATGCGGTGGAGGCCCTCAGGGGCCTAGACAACACAGAGCCGCAA
G
Sequence Type mRNA
Unitrap ID UNI100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4792398..4793809 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056951 (Rbm4) NM_009032 RNA binding motif protein 4 Gene [Source:MGI Symbol;Acc:MGI:1100865]

 
Come back to gene ENSMUSG00000056951


For any suggestions or comments, please send an email to unitrap@crg.es