Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10592G10
Clone ID IST10592G10
Vector VICTR76
Project tigm

Sequence tag IST10592G10HMF1
Sequence
ATCTTGTCCCCTGGCCTGTGATCTCGGNCTATCTATCTCCTTCCCACACACCAGCTGGCTGCCTGTGGTTCGCTTCATTG
AGGAGCAGTTTGAGCAATACCTCAGGGATGAGAGTGGCTTGAACAGGAAGAACATCCAGGATTCCAGAGTCCATTGCTGC
CTCTACTTCATCTCACCCTTTGGCCGAGGGTCTGGAGAGCACCCTGGGGGTGGACTGGTTGGGGAGGCTGGAGAAAGCTC
AGTACTTGAAGCTGAGTCCTGACNNATAAATCCCTGAAACAGGCTCCGGCCCCTANNTGTGGCTTTCCTCCGGGCAGTGC
ACGAGAAAGTCAATATCATCCCGGTCATCGGTAAAGCAGACGCCCTGATGCCTANGGAGACTCAGGCCCTCAAGCAGAAN
GTATGGCTGANGCCCCTAAGTGACAGCCAAGGCCATGATTCAACCTTGTCTGTCTGGACTTTTTTTTTNAATCTTGGGGT
GANCTTTTTGGGGGTGGGGTGAGGAAAGGGTNATGATCCC

Sequence Type genomic DNA
Unitrap ID UNI23202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134360086..134360603 495
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000486 (Sept1) NM_017461 septin 1 Gene [Source:MGI (curated);Acc:Sept1-001]

 
Come back to gene ENSMUSG00000000486


For any suggestions or comments, please send an email to unitrap@crg.es