Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M009B04
Clone ID M009B04
Vector U3betageo
Project ggtc

Sequence tag M009B04
Sequence
GAGATCTTCCTCAGTCAGCCTATCCTTTTAGAACTTGAAGCACCACTCAAGATATGTGGTGACATCCAACGGGCAGTACT
ATGATTTGCTCCGTCTGTTTGAATACGGTGGCTTTCCTC
Sequence Type mRNA
Unitrap ID UNI5533

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122618258..122618987 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es