Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12395G6
Clone ID IST12395G6
Vector VICTR76
Project tigm

Sequence tag IST12395G6HMF1
Sequence
TAGGGAAGGTTTTAGTCCTCTGGTGCTGTCATAAGGATAGTCTGGGTGACCTGTTGGTGGCTTGTCCTTGTTCCGAGCAN
CAAGGAGTGCANTCAACG
Sequence Type genomic DNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23733542..23733638 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]


Sequence tag IST12395G6BBF1
Sequence
TAGGGAAGGTTTTAGTCCTCTGGTGCTGTCATAAGGATAGTCTGGGTGACCTGTTGGTGGCTTGTCCTTGTTCCGAGCAG
CAAGGAGTGCAGTCAACAGCTGTCATGTAAGGAGTCAAATCACCTCACCTCCAATGTATGTGCTTAATTATAGAAAAATG
AACATTGCAGGAACACTGGTGGGTGTTAATAATCTAATAGTGATTATTAATTTCTTTGAGACAAGGTTTTATCATGTAAT
AGTGGCTGTCCTGGAACTCACTGTATAGACCAGGTTGGCCTTGACTCAAGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23733341..23733638 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]

 
Come back to gene ENSMUSG00000062012


For any suggestions or comments, please send an email to unitrap@crg.es