Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M005A03
Clone ID M005A03
Vector U3betageo
Project ggtc

Sequence tag M005A03
Sequence
GGGGCCTTTAAAAAAAAAGTTGATTCGGTGCATGAAAGCAAGTTAACTACTGCTGCTCACCGTTGAGAGACTTACAGGTG
CTTGCCTGAACTGCAATAAAGGACTCATATTATTGAGCAGGACTTATTTATCTCTTCATGTTGGAGAGCCTCATAAACTG
TTATTACAGTTTCTCTACT
Sequence Type mRNA
Unitrap ID UNI11972

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44415247..44415424 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es