Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10890F8
Clone ID IST10890F8
Vector VICTR76
Project tigm

Sequence tag IST10890F8HMF1
Sequence
CCCTGTCTCAAAAAAACCAAAAGAAGAAAAACANANNANTCCCCTTTCATGTATAGAGGGTCCTTTACTTTGGAGTTTTG
CCTCTTGTTTGTCTGTTTCTTTATTTAAGACAATGTCTCACTATGTANCGCAGGCTGGCCTGCAATTCTCTTTTCTCAGC
CCCACAAATGCCGGAGTTACAGGTGTGTACCCCTAAATCCANCTTTTGTTTGAGGTCNAGTCTTTCCTTATAATGGCTAT
GGCGACNCGGTGGCATGTATCTGTAATTCCCGGCACCTGGGAGGTGGAATCCAAGAGGATCAAATGTTCNAAATCNCCCT
NNNTGAATACAGAGTTAGAGGCCNNTCCGGANTACATGANATTCCGTTTTTCAAAACAAAGAANNGACANGATTCNNGGA
TTAAATGGCTCAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10890F8HMR1
Sequence
NGGTTTCTCTGTGTACCCTGGCTGTCCTGGAACTTACTCTGTN
Sequence Type genomic DNA
Unitrap ID UNI28219 UNI33307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 58257438..58257478 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30827803..30827843 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033826 (Dnahc8) NM_013811 dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 97838665..97838705 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 16932225..16932265 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020580 (Rock2) NM_009072 Rho-associated coiled-coil containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:107926]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 140094108..140094148 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 37194616..37194656 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 96221538..96221578 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100540459..100540499 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 102833398..102833438 39
NO GENE  

 
Come back to gene ENSMUSG00000020580


For any suggestions or comments, please send an email to unitrap@crg.es