Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12740C8
Clone ID IST12740C8
Vector VICTR76
Project tigm

Sequence tag IST12740C8HMF1
Sequence
TTGGTAGTAAGTGGCCTCTCTGTGAAATAAGCCCATGACTGAGCCAATGTGCAGAGGCCTCTGTGGTCCACTCTTANTGT
GTGCTCCTTTTAAAGACCCTCTCTATGCCTGTTCCTTTGACTTCTCTGTGTGCACTAACCATGCCTCAGTCCATACCCTG
CTGCATGAACTGCTACGCATGCCGGTCCTTCCAAAAGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI31512

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28929535..28929734 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026803 (Ttf1) NP_033468 transcription termination factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ttf1-001]

 
Come back to gene ENSMUSG00000026803


For any suggestions or comments, please send an email to unitrap@crg.es