Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A003F08
Clone ID A003F08
Vector pT1ATGbetageo
Project ggtc

Sequence tag A003F08
Sequence
AGTGTGTTTTCTTCCTTTAAGCCGTCGTTCTTTTCTTGGTTTCTTTTCTAGTTTTTTAAGAGCGAGAGTGGCCTTGGCGG
CGACGGTTTACGGTAGGCGCCGCGGAGGTGAGGGCGGCTCGCCTCCCGCGCTCTCGTAG
Sequence Type mRNA
Unitrap ID UNI12688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97125397..97125535 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031774 (2310065K24Rik) NM_028221 RIKEN cDNA 2310065K24 gene Gene [Source:MGI Symbol;Acc:MGI:1919637]

 
Come back to gene ENSMUSG00000031774


For any suggestions or comments, please send an email to unitrap@crg.es