Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A001C07
Clone ID A001C07
Vector pT1ATGbetageo
Project ggtc

Sequence tag A001C07
Sequence
ACCGGCAGGCGGCAGCAGCAACTACGGCGGCGGCGGCAGAACCCAGCAGTGATGTGGAGGTGGAGACTCACGGGAGCCCC
GGACTTCACCTGAGCTACCTCAG
Sequence Type mRNA
Unitrap ID UNI12693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127983884..127984788 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039810 (Zc3h10) NM_134003 zinc finger CCCH type containing 10 Gene [Source:MGI (curated);Acc:Zc3h10-001]

 
Come back to gene ENSMUSG00000039810


For any suggestions or comments, please send an email to unitrap@crg.es