Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F028C01
Clone ID F028C01
Vector pT1ATGbetageo
Project ggtc

Sequence tag F028C01
Sequence
ACTTAGNNANNCAGACAACGAGGAAAAGAGAGGGGGGAGGAANNAACCCACCGTGTGTGCGTGAACGGGGNNGGGGAGGA
CTCGCAGACTTTGCGCTTGGGGAGACGTGTAGAGGCCGGGTTCGGCATTTATTGAACTCTCACCCCAGCGCGTGGGTTTC
TCTTTCCGGGACAAGATGGCGCCGTCCACACCGCTGTTGACAGTCAGAGGATCAGAGGGACTGTACATGGTGAATGGACC
ACCACACTTCACAGAAAGCACGGTGCTTCCCAGAGAATCTGGAAGAAATTGCAAAGTGTACACTTTTAGTAAGGATGGGA
CATTGTTTGCCTGGAGCAATGGAGAAAAAGTAAATATAATCAATGTCGCTAACAAGGGACTACTGCACTCCTTCGACCTC
CCAAAAGCAGTTTGCAGTGAATTCTCACCATTTAACACTGTCCTGGCGGCTTGCAGCCTNNTNNNG
Sequence Type mRNA
Unitrap ID UNI12695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58329884..58343561 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es