Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15088D10
Clone ID IST15088D10
Vector VICTR80
Project tigm

Sequence tag IST15088D10HMF2
Sequence
CCCTTTAGTCTTGCGGTACAGCCCATCGCTAGCCCCAGACTGTGGCATCTATCTAGACCTCCTGTCTGGTGTTCACTGAT
GTGTATGGACACACCCGGCACACTGATGTCTGTCTTCACCCTCTAGTTGTGGTTCATTTTCTTTATGTGCACATAGGAGG
GTTTTACAGTTCACATAGCTTCCCTTGCAATGTTCAGGTGGTATCTGGCTAATTGGATCAAGAATGGCAGACAAAGCTCA
CATAATAACAGATCAGTGTTCATAAATGGCGGGCTGTAATTATGAAGGACTGGAGAGAGATGGCGTTGGTGGAGTTTGGG
GCCCNNTTCTTCTACTCTCAGCTGGCCCTGGTCTCCCTGANCTTGCTTGCTTTTNNTTTCNTTTTCTGACTTCTTTCCTT
TTN
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109972543..109972943 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]


Sequence tag IST15088D10HMR1
Sequence
NGAANGCNNGGTANGCNGAANAAACAANTACCTCACCCCTGGGCNCANNGTGCANAAATGGGGCTCATTGCTCCCCATAT
TCTGGTCTCATAGCTTGCTGAGATGGTATGCTGCACACAGCCCGAGATCCTTCTGGCTACCGTTTCTCTTAAGGGCCTGG
CCCTGGGTGAACGGGAAAATGTCTTCTTCCTCGTCTGCCATTGGTGTGCTCCCACAATGCCTAGGGCTTCCCCCACTTCC
AAACCACCGTTACACAGTCACACCAGATACAAACTGCGCAGGTGCGGGACAGTGTCGTTCTTCCCAACTTGATCTGGGGT
TCTCAGCATACACCCGAGGCAGATTAAGTTGGGGTGCTAGCTGGGTTCATGTGATTTGACGCTTGGTTGAATGGACAGTT
GGGGTTTTCTAGACCCCCACTCTTCTACCAGTAAGGGTTATAGCCTTCATATAATGGGGAGCAAATAAGGCACGCTTCAC
CCATATGANGGCCCAACAGGCAGGGAATGCCCNGCTTGCTGCCTANCNNTTGAGGAN
Sequence Type genomic DNA
Unitrap ID UNI36500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25015967..25016501 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046070 (Igfals) NM_008340 insulin-like growth factor binding protein, acid labile subunit Gene [Source:MGI Symbol;Acc:MGI:107973]


Sequence tag IST15088D10BBF1
Sequence
CCCTTTANTCTTGCGGTACAGCCCATCNNNANCCCCANACTGTGGCATCTATCTANACCTCNTGTCTGGTGTTCACTGAT
GTGTATGGACACACCNNGNNCACTGATGTCTGTCNTCACCCTCTANTTGTGGTTCATTTTCTTTATGTGCACATAGGAGG
GTTTTACANTTCANATANCTTCCCTTGCANTGTTCANGTGGTATCTGGCTAATTGGATCAAAAATGGCAGACAAAGCTCA
CATAATAACAGATCAGTGTTCATAAATGGCGGGCTGTAATTATGAAGGACTGGAGAGAGATGGCGTTGGTGGAGTTTGGG
GCCCATTTCTTCTACTCTCANCTGGCCTGGTCTCCCTGANCTTGCTTGCTTTTCTTTTCTTNNTCNGACTTCTTTCCTTT
TGTTNCTTCTNCTTCCCCTCCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000046070


For any suggestions or comments, please send an email to unitrap@crg.es