Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14628E10
Clone ID IST14628E10
Vector VICTR74
Project tigm

Sequence tag IST14628E10HMR1
Sequence
NCCCCACAGAAGCTAGTTGGGCCCACATGGGCCNACGATTGGCTGGGAGGATGANAAAAATGACTTTACAATAATGTTTT
CTTTTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI15390 UNI31035 UNI32369 UNI33033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32508929..32509016 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024050 (Wiz) NM_212438 widely-interspaced zinc finger motifs Gene [Source:MGI Symbol;Acc:MGI:1332638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3232932..3233019 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52078765..52078852 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8740274..8740361 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7802621..7802708 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19014291..19014378 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5221737..5221824 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 128889157..128889244 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000248 (Clec2g) NM_027562 C-type lectin domain family 2, member f Gene [Source:MGI Symbol;Acc:MGI:3522133]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14345762..14345849 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88594394..88594481 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40552986..40553073 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3329083..3329170 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15919455..15919542 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110305197..110305284 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6001014..6001101 84
NO GENE  


Sequence tag IST14628E10HMF2
Sequence
NGGCNGANTCTTANNACNCANTTTCCCCTGTTNNNNGCAGATGATCTAGTTGTGTGCTGTAGATGGTGTTTTAAAATGCT
GAACTATCAAACCTTAATTTGTATATTAATAGTCAATGCCATATCTCTGAGCTCACAATTGCTTAAATTGTTCATCCCTC
AAATACTATTAATTCTCAAATTTACAATTGCTTATGCATATTTCTAGTTAATAAATAAATTATGCACATGTGACTCTTAA
TAACTTTACAAGCCTTCTAGTTACAACTGCTCCTTAAAAAAATTGATTAANAGTGCAATTNGTCACTGACCCTTTACAGC
CAAGTATTTAAAATGTTTTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14628E10BBF1
Sequence
CACTGAACTCCCTAGAGATGGTTATGAACCATCACACCGGTGCTGGGAACCAAACTTGGGGCCTCTGGAACAGCAGCAGT
TGCTCTTAACTTCTGAGCCNTCTCTCCAGTCCCTAAACACAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102499315..102499441 125
 
EST/CDNA Est Name
  BB566431.1

 
Come back to gene BB566431.1


For any suggestions or comments, please send an email to unitrap@crg.es