Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A006F02
Clone ID A006F02
Vector pT1ATGbetageo
Project ggtc

Sequence tag A006F02
Sequence
TCTCCCGCCACAGTGGAAGTCCACGGTGAGCCCAGGTGCTCCTCAGCTTTCTAGCAGAAGCATCTCTGCCTCCTCGGTGG
GCAGCAGTCTTCAGGATCACCAAGAGAAGGCAGGACCTCAGAGGGCCTCTTTTGCCAATGTCTCCTCTCCCGAGTTGACT
GTACCCCAGGCAGCCCACTCTGTGGTGGGGGCAGGGCCTCCGCTCCAGGGGTCAGCACAGCCTCTGACCTCTGGCAGTGA
TGCTACAGGCCTGG
Sequence Type mRNA
Unitrap ID UNI6372

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20140278..20140531 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es