Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F012A01
Clone ID F012A01
Vector pT1ATGbetageo
Project ggtc

Sequence tag F012A01
Sequence
TGCAGTTCAGCGGCTCCCTGCACACAAAGCTTTACCAGGAAGTGGAGATTGCCAGTGTGGACGCCTTCCAGGTCCGGGAG
AAGGACTTCATCATTCTGTCCTGCGTGCGCGCCAATGAACATCAGGGCATTGGGTTCCTAAACGACCCCCGGCGTCTGAA
TGTGGCTCTCACCAGAGCAAGATATGGCGTGATCATTGTGGGTAGCCCAAGGGCCCTGTCGAAGCAGCCCCTGTGGAATC
ACCTGCTGAGCTACTACAAGGAACAGAAGGCGCTAGTGGAAGGGCCGCTCAACAACCTACGTGAGAGCCTCATGCAGTTC
AGCAAGCCTCGCAAACTTGTCAACACTGTCAACCCGGTGGGCCTAGGGGCTGGCCTGGGACCTGGGAAAGCAGCCCAAAA
GG
Sequence Type mRNA
Unitrap ID UNI12708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72857937..72859169 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058301 (Upf1) NP_001116301 UPF1 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107995]

 
Come back to gene ENSMUSG00000058301


For any suggestions or comments, please send an email to unitrap@crg.es