Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14225F2
Clone ID IST14225F2
Vector VICTR74
Project tigm

Sequence tag IST14225F2HMF1
Sequence
CCAGCTCGTCACACGAATTAATATGTTTTTGAAGCGTTTTGTGGAGAAAACCTGTTTTTCCCTTTTCTAATAAGGTAGCT
GTTTTAGGATCAATCTATAAGCCAATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAA
ATATTAGATTTTGAAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGATACAATT
TCTCTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124749408..124749723 316
 
EST/CDNA Est Name
  AI153827.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136940229..136940544 316
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52919677..52919992 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469503..7469818 316
NO GENE  


Sequence tag IST14225F2BBF1
Sequence
CCAGCTCGTCACACGAATTAATATGTTTTTGAAGCGTTTTGTGGAGAAAACCTGTTTTTCCCTTTTCTAATAAGGTAGCT
GTTTTAGGATCAATCTATAAGCCAATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAA
ATATTAGATTTTGAAAATAAAGGTAAGACTTAAATAGTGTGCATGGGAATGCACTAAATAGTATGCACGGAGATACAATT
TCTCTCTTTTTTGTCTTTTAANAAGTTAAAGTTTTAAAATTTTACAATACCTAAACCTTTGAATTAATAACTANTTGACA
AAACATTTTAAATACTTGGCTGTAAAGGGGCAGTGACTAATTGCACTTNNNNNNNATTTTTTTAAGGAGCNNNNNGTAAC
TANAANGCNNGTAAAGTTATTAAGAGTTACANGTGCATAATTTATTTANTAACTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es