Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F010D02
Clone ID F010D02
Vector pT1ATGbetageo
Project ggtc

Sequence tag F010D02
Sequence
TCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCTGTCAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGACACACCTG
AAGAAAAAATAAGAGAGTACTTTGGTGGTTTTGGTGAGGTTGAATCCATAGAGCTCCCTATGGACAACAAGACCAATAAG
AGGCGTGGGTTCTGTTTTATTACCTTTAAGGAAGAGGAGCCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGG
TCTTAGTAAATGTGAAATAAAAGTAGCCATGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGATCTAGAGGAGGGT
TTGCAGGCAGAGTTCGCGGAAGAGGTGGAG
Sequence Type mRNA
Unitrap ID UNI12712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100393670..100395158 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es