Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11762G3
Clone ID IST11762G3
Vector VICTR76
Project tigm

Sequence tag IST11762G3BBF1
Sequence
TTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTT
Sequence Type genomic DNA
Unitrap ID UNI10487 UNI22224 UNI31078 UNI33320 UNI33321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 14925491..14925547 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24586696..24586752 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20020585..20020641 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 46266169..46266225 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 10181356..10181412 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27223595..27223651 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 11130542..11130598 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 7187834..7187890 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13954230..13954286 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 8605204..8605260 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24619093..24619149 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024867 (Pip5k1b) NM_008846 phosphatidylinositol-4-phosphate 5-kinase, type 1 beta Gene [Source:MGI (curated);Acc:Pip5k1b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32021356..32021412 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 28807504..28807560 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074655 (Gm1527) NM_001033479 gene model 1527, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2686373]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 16675321..16675377 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 15335248..15335304 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38674783..38674839 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 12037737..12037793 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 36272886..36272942 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8455715..8455771 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161925: 16991..17047 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079809 (AC181976.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 33828221..33828277 57
NO GENE  


Sequence tag IST11762G3HMF2
Sequence
TTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTTAATGTAAGTACACTGTTGCTGTC
TTCANACACACCAAAAGAGGGCATCANATCTCATTACNGATGGTTGTGAGTCACCATGTGTTTGCTGGGATTTGAACTCA
NGACCTCTGGAAGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130174846..130175019 164
NO GENE  

 
Come back to gene ENSMUSG00000079809


For any suggestions or comments, please send an email to unitrap@crg.es