Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W015G12
Clone ID W015G12
Vector pT1betageo
Project ggtc

Sequence tag W015G12
Sequence
TGCTTGTGGGAGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAGAAAAGCCTCCCGTCGCACCGTCTGTCTTTG
TGTTTCAAAAGGACAAAGGACAGAAGAGATCTGCTGGCAGCTCCAGTCCCGAAGCCGGAGAAGATTCTGCCCATGAGGAT
GGAAACTACTGCCCCCCTGTCAAGCGTGAGCGGACATCCTCTCTAACTCACTCAG
Sequence Type mRNA
Unitrap ID UNI12719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56812787..56836212 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]

 
Come back to gene ENSMUSG00000002372


For any suggestions or comments, please send an email to unitrap@crg.es