Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10607B3
Clone ID IST10607B3
Vector VICTR76
Project tigm

Sequence tag IST10607B3HMF1
Sequence
ATAATAATAAAAATAAAGTAAGATAATAACTGGGGTGGTGAGATGGCTCANTGGTTTAAGGAACTTTCAGCTTGGAACTG
AACCTGCAGGCTGGTTAAGTGCAGCCTAATACCTGAACCATTAAACCATCTCCCCAGTTTCATTGTAAAAGTTTGACAGT
CTTATATAACACAAGTTTCAGCCAGATAATCACTCAATTAAACCTGAATTCAATGAATTCAATCCCNGGGGACCCATGTG
ATGGGAGGAGAAAACGAACTCCTCTAAAGTGTCCACACNCACNCACACACACACACACACNCNCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4799952..4800257 294
NO GENE  


Sequence tag IST10607B3HMR1
Sequence
TTTATGATTTNATTGATGTATCCAACGGTGGCACAGAATTAACAGATATCTTGCAGCCTCCACCTTTGATAACCTTCAAA
TTAACCTTCTAGTTCTAACCTGATGTTCAACTAAGTTTTCCTTTTAGTGGGTAATTTCTTTTTCCCTTTCTTTCTCCCTC
CCTTGCCTTGACATGCACAGCTTTGTTTGTTTGAGATTGTCTGTGCTTGCCTGAGCTCACTGTAAACCGGCTTGATCCTA
ACTTGTGATCCTCTGACCTCTGCATTCCCAAANNNNTNTTTCCNGGTGTTTGCCACCATGACNTTNANTCTATGGGAGCA
AGAGTTCTTTTGTGTGTGAGTGCACATGTNCNNGTACATGTGGANGCTN
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4800254..4800620 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST10607B3BBF1
Sequence
ATAATAATAAAAATAAAGTAANATAATAACTGGGGTGGTGAGATGGCTCANTGGTTTAAGGAACTTTCAGCTTGGAACTG
AACCTGCAGGCTGGTTAAGTGCAGCCTAATACCTGAACCATTAAACCATCTCCCCAGTTTCATTGTAAAAGTTTGACAGT
CTTATATAACACAAGTTTCAGCCAGATAATCACTCAATTAAACCTGAATTCAATGAATTNNATCCNNGGNGACCCATGTG
ATGGGAGGANAAAACNAACTCCTCTAAAGTGTCCACNCNCNCNCACACACACACACACACACACACACACAAAAAANANN
TGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es