Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14401G5
Clone ID IST14401G5
Vector VICTR74
Project tigm

Sequence tag IST14401G5BBF1
Sequence
ACGCTAAGACAAGGCTATCCTTCCATGATCCAACTGGAGTGGGGCAACTTAGCAGGGCTCTGACAGCCACAGAGAATGGC
TGTGGACTGACATGGGGCACCCATTGGCAAGAACAATCCAGGGACAGAACTGGATGAAATAAGGGGGTGGGGAGAGCCNG
CTCACTCCCGTCCCACCTCTACTTCCTGGCCACCAGGATGTGACCTGTGTCTCCCCACCACGAAGGAATGANCCCTTTGN
NGNGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28419591..28419829 235
 
EST/CDNA Est Name
  BI218278.1


Sequence tag IST14401G5HMR1
Sequence
TTGTATACCATCATTCCGCGTATAGGTAAGAATAACTGTAGACACTGCCTACAAGTGGGGCTTCGGGGTCCAAGCAAGTG
CACTCCTCCTTACTGTGAAGGCCAAACCAGTACAGACC
Sequence Type genomic DNA
Unitrap ID UNI8333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28419828..28419943 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002250 (Ppard) NM_011145 peroxisome proliferator activator receptor delta Gene [Source:MGI (curated);Acc:Ppard-001]


Sequence tag IST14401G5HMF1
Sequence
ACGCTAAGACAAGGCTATCCTTCCATGATCCAACTGGAGTGGGGCAACTTAGCAGGGCTCTGACAGCCACAGAGAATGGC
TGTGGACTGACATGGGGCACCCATTGGCAAGAACAATCCAGGGACAGAACTGGATGAAATAAGGGGGTGGGGAGAGCCAG
CTCACTCCCGTCCCACCTCTACTTCCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28345106..28419829 192
NO GENE  

 
Come back to gene ENSMUSG00000002250


For any suggestions or comments, please send an email to unitrap@crg.es