Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10875A1
Clone ID IST10875A1
Vector VICTR76
Project tigm

Sequence tag IST10875A1BBF1
Sequence
AACTTACTNATNANGAGGAGANGGGGGGNGNGGGGGGAGCCTGGAGAGATGGCTCAGTACTTAAGAGCACACTGACTGTT
CTTCCGAAGGTCCCGAGTTCAAATCCCAGCAAACACGTGGTGGCTCACAACCATCATCATGATCAGATCATGAGATCTGT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10875A1HMR1
Sequence
AGTTNAGTATACTGTGCAGCTTCTCCACTGACTTCCCGTCCCGCCCACAGCCCTCCAAACTTAAGCCCAGGTCATTGCAG
TCGAATAGTGCCCCTGAGCTACATCCCCAGCCCCCAACTTAACGCTTTTAAGAAAACTTTAAAAAGCCAGGTATGGTGGC
GCATGCCTTTAATCCCAGCACATGGGAGGCAGAGGCAGGCGGATCTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGCAAG
TTCCAGGACAGCCAGGGCTACACAGAGAAAGCCTGTCTAGGGAAAAAGGGGGCTTAGACTTGACCATTGTAGGATAGGAA
ATTCAGCATTGTTTGCTATCCATGAANGGCTGCGCAGACACATCCAGAATGCAGGCTNNGCTGGGCCC
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165633907..165634293 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST10875A1HMF1
Sequence
AACTTACTNATNANGAGGAGATNGGGGGTGNGGGGGGAGCCTGGAGAGATGGCTCAGTACTTAAGAGCACACTGACTGTT
CTTCCGAAGGTCCCGAGTTCAAATCCCAGCAAACACGTGGTGGCTCACAACCATCATCATGATCAGATNATGAGATCTGA
TGCCCTCTTCTGGTGCATTAGTGTACTTANATTAAATAAATCTTTAAAAAATAAAATGAAAAAGGGAAGATGGTANCAGC
TGCAGAGGTGCCNNCTTGTACTATACCCCATTCANGGTACTTNNNNNANNCNCNCCAAACATGGTGGGGGGGGGGTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es