Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W025A03
Clone ID W025A03
Vector pT1betageo
Project ggtc

Sequence tag W025A03
Sequence
TCTTCAAAGGAAAAACATTTGTGTTTTTAAATGCCAAGCAGCACAAGAAACTCAGCTCGGCAGTTGCTTTCGGAGGTGGA
GAAGCCAGGCTGATGGCAGAAGACGACGAAGAGGAACAGAGCTTCTTTTCAGCTCCCGGAACCTGCGTTGTTGATGTAGG
AATAACGAATACACAGCTCATAATTTCACACTCCCAGAAAAAATGGATTCATTTGATAATGGATACACTTCAAAGGAATG
GTCTCAGACCTATTCCTGAAGCGGAGATTGGATTGGCTGTTATTTTTATGACCCCCCCTATTTTTTCCCCCCGGGGGGAT
TAAC
Sequence Type mRNA
Unitrap ID UNI12722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15896565..15898969 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028224 (Nbn) NM_013752 nibrin Gene [Source:MGI (curated);Acc:Nbn-001]

 
Come back to gene ENSMUSG00000028224


For any suggestions or comments, please send an email to unitrap@crg.es