Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12312A7
Clone ID IST12312A7
Vector VICTR76
Project tigm

Sequence tag IST12312A7BBF1
Sequence
CTCCTATCAGATTGGCCTGTAGGCAAGCCTGTGGATCATTTTCCTGATTAATGTGAGAGGGACCAGCCCACTGTGGACCA
TGCTAACCCTGGGCTGCATAAGAAAGCTAGGAACTGATCAAGCCTTAGGGACAAACCAGGATCTCCGTACCAGTTTCTTC
CTCAGGCTCCCCCATTGATGGACTGTGTATGGTTGACGTATTAGCTAGCTAGATAAGCCCTTTCCTCCCCAAGTTGCTTT
TGGTCACAGTTCTTATCACAGCATAGAAAGCAAATTGGAATACCCCTTCCACCACCTCTTTTTTTTATTTTTGGGCAAGA
TCTGT
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21154269..21154592 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST12312A7HMF1
Sequence
CTCCTATCAGATTGGCCTGTAGGCAAGCCTGTGGATCATTTTCCTGATTAATGTGAGAGGGACCAGCCCACTGTGGACCA
TGCTAACCCTGGGCTGCATAAGAAAGCTAGGAACTGATCAAGCCTTAGGGACAAACCAGGATCTCCGTACCAGTTTCTTC
CTCAGGCTCCCCCATTGATGGACTGTGTATGGTTA
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21154269..21154462 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es