Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W005C03
Clone ID W005C03
Vector pT1betageo
Project ggtc

Sequence tag W005C03
Sequence
AGAGCTTCAGAAACGGGCTGAAAAATCCAAGGAATTTGAACCGGANNNCCACCAGTTTCGAGGACAGGGAGTTCCATCTC
AAATCCCAGGTCCACCTCCACCACCTCCANNNCCAGGTGCAGGACCATGCNGCACCACNNNCCACCTCCTCCTCCTCCAC
CACCTCCACTTCCAGGAGTCGTCCCTCCTCCTCCTCCACCATTACCTGGGATGCCTGGTATTCCACCACCACCTCCACCA
CCTTTGTCTGGAGTACCTCCTCCACCACCACCCCCTGGGGGAGTTTTTCCTCTCCTATCAGGACCAATTGAGCTACCATA
TGGAATGAAGCAGAAAAAATTATATAAGCCTGACATACCTATGAAAAGAATCAACTGGTCCAAGATTGAGCCTAAAGAAT
TATCCGAAAACTGTGTTTGGCTAAAACTTAAAGAAGAGAAGTATGAGAATGCAGATCTATTTGCAAAACTGGCCTTGACA
TTTCCTTCCCAGATGAAAG
Sequence Type mRNA
Unitrap ID UNI11818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126501100..126507145 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es