Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W007D08
Clone ID W007D08
Vector pT1betageo
Project ggtc

Sequence tag W007D08
Sequence
CTTGGACATCAACGGGGTCAAGACGGTACTGGTCTCCCGGCTGAAGCAGGCTATTGAAGAGGAAGGAGGCGATCCAGATA
ATATTGAATTAACTGTTTCAACTGATACTCCAAACAAGAAACCAACCAAAGGCAAAG
Sequence Type mRNA
Unitrap ID UNI107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70390840..70391864 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032212 (Sltm) NM_025690 SAFB-like, transcription modulator Gene [Source:MGI Symbol;Acc:MGI:1913910]

 
Come back to gene ENSMUSG00000032212


For any suggestions or comments, please send an email to unitrap@crg.es