Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11584A11
Clone ID IST11584A11
Vector VICTR76
Project tigm

Sequence tag IST11584A11HMR1
Sequence
CTCTTTTTTTTATTTTTGGGCAAGATCTGGTTTTGAACTCTATAATGTAGGTGGGTTTGAAATCACACTATTAACAAGAT
GATTGAAGTTGCAGTTTTCTTGTCTTANCCTGTCTAGTGTATAAACTGANGATATTACCACCTCAAGTTATGGTTGAAGG
AGAGACTGAGGAGGANAAAGAGACNACTAANAGAGATGGGCGAGAGAAAGGGGACCAAAAAAGTGCATANCTGAAAGAAA
TAGTANAGTTTAAGGGAATGANTGANAAGCTCAGGGGAGGAGATCCCATGANCTGAAGTTAATAAGGTAGACTCAGGGTG
CCAGTATGCNTGGNCTN
Sequence Type genomic DNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21154564..21154899 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]


Sequence tag IST11584A11HMF1
Sequence
CTTTCTATGCTGTGATAAGAACTGNGACCAAAAGCAACTTGGGGAGGAAAGGGCTTATCTAGCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21154474..21154538 63
NO GENE  

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es