Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W015H01
Clone ID W015H01
Vector pT1betageo
Project ggtc

Sequence tag W015H01
Sequence
ACTGATGCAAAACAGGTCTCAGCGTTTGAATTTTGATGTATCCTCTCCTAATGGAATTCTTCTCCTCCAGGGAAGCCAGC
AAAGTGGGGTGCGCGGACG
Sequence Type mRNA
Unitrap ID UNI12727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33183908..33189578 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es