Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14218C11
Clone ID IST14218C11
Vector VICTR74
Project tigm

Sequence tag IST14218C11HMR1
Sequence
AAATGGATTGGAATTGTGGTAGGTTNAAAGATGTGGGCAGGGAGGAAGGTANGGAAN
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32399803..32399858 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


Sequence tag IST14218C11HMF1
Sequence
ATTTTATCTCTTTAAAAATCATTCAGAGAAGTATGTTGTAGCACAAATGCCAAAAGCCACCAGATCCCCTGCTGTCTGTT
TGCCCACAGGAACACAGAGTGTGTTTGGGCACATGTGGTCCTCAACAGTTTCTAAACAACCATTTTTGCACCAGAAGGCT
TAGCTCAGGCTCAATGCTGCCAGCTTCCTATCACAGTTATGTGGGGAATAAGTAGGCCTTGAACACAGCTTTGTGACCCA
NGCAGGAATACAGGAAACGGTTACCATATATTTATAGTCTCTGTCTGTCTGTGTGTGTGTGTGTGNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32399855..32400162 304
 
EST/CDNA Est Name
  BY004415.1 - AI463857.1 - AA270132.1 - BY779550.1 - CJ180274.1 - BQ958093.1 - CJ126116.1 - CJ109545.1 - BE656039.1 - CJ185081.1 - CJ186068.1

 
Come back to gene BY004415.1 - AI463857.1 - AA270132.1 - BY779550.1 - CJ180274.1 - BQ958093.1 - CJ126116.1 - CJ109545.1 - BE656039.1 - CJ185081.1 - CJ186068.1


For any suggestions or comments, please send an email to unitrap@crg.es