Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W007C10
Clone ID W007C10
Vector pT1betageo
Project ggtc

Sequence tag W007C10
Sequence
GACTGCAGGAGAAGTGGAAGCCCTGTCTGTGGAATTCAGGCAGTACATTCAGGATGATAACTGGAGGTTTCAGCAAGAGG
TGGAGGACTGGGAGGAAGAACAGTCCTGTAAGTTCCCACAGATGGAATCCTCCCCGAACTCTTCCTCACAGGATTTATCC
ACATCACAAGAGTCACCAGCAGTGTCCTCTCATGAGGTCCGATGCTTGTGTTGTGCGCATGCTGTGATTGCAAAAGAACG
GATCCTCCCGGAAATTTTCATCACAGGATTTGCCCACGTGACGAGTGTTCTCGACGCTGCCCTGTCTTGAGGTCCGATGC
TTGTCTTCTGAGACATGCTCTGATTGCAAACGAACAGATTTCCCAGGCAACTTACCAACACAGCNNTATGCACACGAGAG
GGGTGGTCACGATGTATCCTTGACCAAG
Sequence Type mRNA
Unitrap ID UNI12735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48838857..48840460 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es